ID: 1012298720

View in Genome Browser
Species Human (GRCh38)
Location 6:97557505-97557527
Sequence ATGGGGAACTCAGAATGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012298720_1012298728 17 Left 1012298720 6:97557505-97557527 CCTTTCCATTCTGAGTTCCCCAT No data
Right 1012298728 6:97557545-97557567 CAACTGCTACAGAGACACGGTGG No data
1012298720_1012298726 14 Left 1012298720 6:97557505-97557527 CCTTTCCATTCTGAGTTCCCCAT No data
Right 1012298726 6:97557542-97557564 TGCCAACTGCTACAGAGACACGG No data
1012298720_1012298722 -10 Left 1012298720 6:97557505-97557527 CCTTTCCATTCTGAGTTCCCCAT No data
Right 1012298722 6:97557518-97557540 AGTTCCCCATAGAGAGCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012298720 Original CRISPR ATGGGGAACTCAGAATGGAA AGG (reversed) Intergenic