ID: 1012298721

View in Genome Browser
Species Human (GRCh38)
Location 6:97557510-97557532
Sequence TCTCTATGGGGAACTCAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012298721_1012298728 12 Left 1012298721 6:97557510-97557532 CCATTCTGAGTTCCCCATAGAGA No data
Right 1012298728 6:97557545-97557567 CAACTGCTACAGAGACACGGTGG No data
1012298721_1012298726 9 Left 1012298721 6:97557510-97557532 CCATTCTGAGTTCCCCATAGAGA No data
Right 1012298726 6:97557542-97557564 TGCCAACTGCTACAGAGACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012298721 Original CRISPR TCTCTATGGGGAACTCAGAA TGG (reversed) Intergenic