ID: 1012298721 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:97557510-97557532 |
| Sequence | TCTCTATGGGGAACTCAGAA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1012298721_1012298728 | 12 | Left | 1012298721 | 6:97557510-97557532 | CCATTCTGAGTTCCCCATAGAGA | No data | ||
| Right | 1012298728 | 6:97557545-97557567 | CAACTGCTACAGAGACACGGTGG | No data | ||||
| 1012298721_1012298726 | 9 | Left | 1012298721 | 6:97557510-97557532 | CCATTCTGAGTTCCCCATAGAGA | No data | ||
| Right | 1012298726 | 6:97557542-97557564 | TGCCAACTGCTACAGAGACACGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1012298721 | Original CRISPR | TCTCTATGGGGAACTCAGAA TGG (reversed) | Intergenic | ||