ID: 1012298723

View in Genome Browser
Species Human (GRCh38)
Location 6:97557522-97557544
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012298723_1012298729 19 Left 1012298723 6:97557522-97557544 CCCCATAGAGAGCTGTTGGCTGC No data
Right 1012298729 6:97557564-97557586 GTGGAGTAGCAGCCTGTCTTTGG No data
1012298723_1012298726 -3 Left 1012298723 6:97557522-97557544 CCCCATAGAGAGCTGTTGGCTGC No data
Right 1012298726 6:97557542-97557564 TGCCAACTGCTACAGAGACACGG 0: 1
1: 0
2: 1
3: 22
4: 194
1012298723_1012298730 28 Left 1012298723 6:97557522-97557544 CCCCATAGAGAGCTGTTGGCTGC No data
Right 1012298730 6:97557573-97557595 CAGCCTGTCTTTGGCCACTCTGG 0: 1
1: 0
2: 0
3: 26
4: 238
1012298723_1012298731 29 Left 1012298723 6:97557522-97557544 CCCCATAGAGAGCTGTTGGCTGC No data
Right 1012298731 6:97557574-97557596 AGCCTGTCTTTGGCCACTCTGGG 0: 1
1: 0
2: 2
3: 21
4: 190
1012298723_1012298728 0 Left 1012298723 6:97557522-97557544 CCCCATAGAGAGCTGTTGGCTGC No data
Right 1012298728 6:97557545-97557567 CAACTGCTACAGAGACACGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012298723 Original CRISPR GCAGCCAACAGCTCTCTATG GGG (reversed) Intergenic