ID: 1012298724

View in Genome Browser
Species Human (GRCh38)
Location 6:97557523-97557545
Sequence GGCAGCCAACAGCTCTCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012298724_1012298728 -1 Left 1012298724 6:97557523-97557545 CCCATAGAGAGCTGTTGGCTGCC No data
Right 1012298728 6:97557545-97557567 CAACTGCTACAGAGACACGGTGG No data
1012298724_1012298726 -4 Left 1012298724 6:97557523-97557545 CCCATAGAGAGCTGTTGGCTGCC No data
Right 1012298726 6:97557542-97557564 TGCCAACTGCTACAGAGACACGG No data
1012298724_1012298731 28 Left 1012298724 6:97557523-97557545 CCCATAGAGAGCTGTTGGCTGCC No data
Right 1012298731 6:97557574-97557596 AGCCTGTCTTTGGCCACTCTGGG No data
1012298724_1012298729 18 Left 1012298724 6:97557523-97557545 CCCATAGAGAGCTGTTGGCTGCC No data
Right 1012298729 6:97557564-97557586 GTGGAGTAGCAGCCTGTCTTTGG No data
1012298724_1012298730 27 Left 1012298724 6:97557523-97557545 CCCATAGAGAGCTGTTGGCTGCC No data
Right 1012298730 6:97557573-97557595 CAGCCTGTCTTTGGCCACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012298724 Original CRISPR GGCAGCCAACAGCTCTCTAT GGG (reversed) Intergenic