ID: 1012298726

View in Genome Browser
Species Human (GRCh38)
Location 6:97557542-97557564
Sequence TGCCAACTGCTACAGAGACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012298720_1012298726 14 Left 1012298720 6:97557505-97557527 CCTTTCCATTCTGAGTTCCCCAT No data
Right 1012298726 6:97557542-97557564 TGCCAACTGCTACAGAGACACGG No data
1012298725_1012298726 -5 Left 1012298725 6:97557524-97557546 CCATAGAGAGCTGTTGGCTGCCA No data
Right 1012298726 6:97557542-97557564 TGCCAACTGCTACAGAGACACGG No data
1012298721_1012298726 9 Left 1012298721 6:97557510-97557532 CCATTCTGAGTTCCCCATAGAGA No data
Right 1012298726 6:97557542-97557564 TGCCAACTGCTACAGAGACACGG No data
1012298723_1012298726 -3 Left 1012298723 6:97557522-97557544 CCCCATAGAGAGCTGTTGGCTGC No data
Right 1012298726 6:97557542-97557564 TGCCAACTGCTACAGAGACACGG No data
1012298724_1012298726 -4 Left 1012298724 6:97557523-97557545 CCCATAGAGAGCTGTTGGCTGCC No data
Right 1012298726 6:97557542-97557564 TGCCAACTGCTACAGAGACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012298726 Original CRISPR TGCCAACTGCTACAGAGACA CGG Intergenic