ID: 1012298727

View in Genome Browser
Species Human (GRCh38)
Location 6:97557544-97557566
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012298727_1012298730 6 Left 1012298727 6:97557544-97557566 CCAACTGCTACAGAGACACGGTG No data
Right 1012298730 6:97557573-97557595 CAGCCTGTCTTTGGCCACTCTGG 0: 1
1: 0
2: 0
3: 26
4: 238
1012298727_1012298734 26 Left 1012298727 6:97557544-97557566 CCAACTGCTACAGAGACACGGTG No data
Right 1012298734 6:97557593-97557615 TGGGACCACAAACTGAGAGATGG No data
1012298727_1012298729 -3 Left 1012298727 6:97557544-97557566 CCAACTGCTACAGAGACACGGTG No data
Right 1012298729 6:97557564-97557586 GTGGAGTAGCAGCCTGTCTTTGG No data
1012298727_1012298731 7 Left 1012298727 6:97557544-97557566 CCAACTGCTACAGAGACACGGTG No data
Right 1012298731 6:97557574-97557596 AGCCTGTCTTTGGCCACTCTGGG 0: 1
1: 0
2: 2
3: 21
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012298727 Original CRISPR CACCGTGTCTCTGTAGCAGT TGG (reversed) Intergenic