ID: 1012298728

View in Genome Browser
Species Human (GRCh38)
Location 6:97557545-97557567
Sequence CAACTGCTACAGAGACACGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012298720_1012298728 17 Left 1012298720 6:97557505-97557527 CCTTTCCATTCTGAGTTCCCCAT No data
Right 1012298728 6:97557545-97557567 CAACTGCTACAGAGACACGGTGG No data
1012298721_1012298728 12 Left 1012298721 6:97557510-97557532 CCATTCTGAGTTCCCCATAGAGA No data
Right 1012298728 6:97557545-97557567 CAACTGCTACAGAGACACGGTGG No data
1012298725_1012298728 -2 Left 1012298725 6:97557524-97557546 CCATAGAGAGCTGTTGGCTGCCA No data
Right 1012298728 6:97557545-97557567 CAACTGCTACAGAGACACGGTGG No data
1012298723_1012298728 0 Left 1012298723 6:97557522-97557544 CCCCATAGAGAGCTGTTGGCTGC No data
Right 1012298728 6:97557545-97557567 CAACTGCTACAGAGACACGGTGG No data
1012298724_1012298728 -1 Left 1012298724 6:97557523-97557545 CCCATAGAGAGCTGTTGGCTGCC No data
Right 1012298728 6:97557545-97557567 CAACTGCTACAGAGACACGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012298728 Original CRISPR CAACTGCTACAGAGACACGG TGG Intergenic