ID: 1012298729

View in Genome Browser
Species Human (GRCh38)
Location 6:97557564-97557586
Sequence GTGGAGTAGCAGCCTGTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012298723_1012298729 19 Left 1012298723 6:97557522-97557544 CCCCATAGAGAGCTGTTGGCTGC No data
Right 1012298729 6:97557564-97557586 GTGGAGTAGCAGCCTGTCTTTGG No data
1012298727_1012298729 -3 Left 1012298727 6:97557544-97557566 CCAACTGCTACAGAGACACGGTG No data
Right 1012298729 6:97557564-97557586 GTGGAGTAGCAGCCTGTCTTTGG No data
1012298724_1012298729 18 Left 1012298724 6:97557523-97557545 CCCATAGAGAGCTGTTGGCTGCC No data
Right 1012298729 6:97557564-97557586 GTGGAGTAGCAGCCTGTCTTTGG No data
1012298725_1012298729 17 Left 1012298725 6:97557524-97557546 CCATAGAGAGCTGTTGGCTGCCA No data
Right 1012298729 6:97557564-97557586 GTGGAGTAGCAGCCTGTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012298729 Original CRISPR GTGGAGTAGCAGCCTGTCTT TGG Intergenic
No off target data available for this crispr