ID: 1012298730

View in Genome Browser
Species Human (GRCh38)
Location 6:97557573-97557595
Sequence CAGCCTGTCTTTGGCCACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012298725_1012298730 26 Left 1012298725 6:97557524-97557546 CCATAGAGAGCTGTTGGCTGCCA No data
Right 1012298730 6:97557573-97557595 CAGCCTGTCTTTGGCCACTCTGG No data
1012298723_1012298730 28 Left 1012298723 6:97557522-97557544 CCCCATAGAGAGCTGTTGGCTGC No data
Right 1012298730 6:97557573-97557595 CAGCCTGTCTTTGGCCACTCTGG No data
1012298724_1012298730 27 Left 1012298724 6:97557523-97557545 CCCATAGAGAGCTGTTGGCTGCC No data
Right 1012298730 6:97557573-97557595 CAGCCTGTCTTTGGCCACTCTGG No data
1012298727_1012298730 6 Left 1012298727 6:97557544-97557566 CCAACTGCTACAGAGACACGGTG No data
Right 1012298730 6:97557573-97557595 CAGCCTGTCTTTGGCCACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012298730 Original CRISPR CAGCCTGTCTTTGGCCACTC TGG Intergenic