ID: 1012298734

View in Genome Browser
Species Human (GRCh38)
Location 6:97557593-97557615
Sequence TGGGACCACAAACTGAGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012298732_1012298734 -6 Left 1012298732 6:97557576-97557598 CCTGTCTTTGGCCACTCTGGGAC No data
Right 1012298734 6:97557593-97557615 TGGGACCACAAACTGAGAGATGG No data
1012298727_1012298734 26 Left 1012298727 6:97557544-97557566 CCAACTGCTACAGAGACACGGTG No data
Right 1012298734 6:97557593-97557615 TGGGACCACAAACTGAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012298734 Original CRISPR TGGGACCACAAACTGAGAGA TGG Intergenic