ID: 1012300361

View in Genome Browser
Species Human (GRCh38)
Location 6:97579944-97579966
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012300361_1012300364 17 Left 1012300361 6:97579944-97579966 CCAAGCATTTAATGGCAGAAGGC No data
Right 1012300364 6:97579984-97580006 CAAGCTGGACACCTTAGTTTAGG No data
1012300361_1012300362 2 Left 1012300361 6:97579944-97579966 CCAAGCATTTAATGGCAGAAGGC No data
Right 1012300362 6:97579969-97579991 CTGCAACAATCTCCTCAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012300361 Original CRISPR GCCTTCTGCCATTAAATGCT TGG (reversed) Intergenic
No off target data available for this crispr