ID: 1012300364

View in Genome Browser
Species Human (GRCh38)
Location 6:97579984-97580006
Sequence CAAGCTGGACACCTTAGTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012300361_1012300364 17 Left 1012300361 6:97579944-97579966 CCAAGCATTTAATGGCAGAAGGC No data
Right 1012300364 6:97579984-97580006 CAAGCTGGACACCTTAGTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012300364 Original CRISPR CAAGCTGGACACCTTAGTTT AGG Intergenic
No off target data available for this crispr