ID: 1012301173

View in Genome Browser
Species Human (GRCh38)
Location 6:97590270-97590292
Sequence AACTATATGAATAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012301173_1012301177 13 Left 1012301173 6:97590270-97590292 CCTTCCTCCTTATTCATATAGTT No data
Right 1012301177 6:97590306-97590328 TTTCTGCCAAAAAATTTAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012301173 Original CRISPR AACTATATGAATAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr