ID: 1012306637

View in Genome Browser
Species Human (GRCh38)
Location 6:97666888-97666910
Sequence TAGGATAGTTAGGAAGATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012306637_1012306642 9 Left 1012306637 6:97666888-97666910 CCTACATCTTCCTAACTATCCTA No data
Right 1012306642 6:97666920-97666942 CTCACTGATCTGATTGATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012306637 Original CRISPR TAGGATAGTTAGGAAGATGT AGG (reversed) Intergenic
No off target data available for this crispr