ID: 1012306871

View in Genome Browser
Species Human (GRCh38)
Location 6:97669340-97669362
Sequence CTCTATTATCAGCAGTGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012306871_1012306873 4 Left 1012306871 6:97669340-97669362 CCAGTGCACTGCTGATAATAGAG No data
Right 1012306873 6:97669367-97669389 AAGTGAGAGTGACAGTCAGATGG No data
1012306871_1012306874 17 Left 1012306871 6:97669340-97669362 CCAGTGCACTGCTGATAATAGAG No data
Right 1012306874 6:97669380-97669402 AGTCAGATGGAAACTGACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012306871 Original CRISPR CTCTATTATCAGCAGTGCAC TGG (reversed) Intergenic
No off target data available for this crispr