ID: 1012316418

View in Genome Browser
Species Human (GRCh38)
Location 6:97786455-97786477
Sequence ACTCTTGGTGTTATATATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012316416_1012316418 -2 Left 1012316416 6:97786434-97786456 CCATAGTTTACATTAGGGTTCAC 0: 173
1: 565
2: 861
3: 873
4: 758
Right 1012316418 6:97786455-97786477 ACTCTTGGTGTTATATATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012316418 Original CRISPR ACTCTTGGTGTTATATATAC TGG Intergenic
No off target data available for this crispr