ID: 1012318629

View in Genome Browser
Species Human (GRCh38)
Location 6:97814099-97814121
Sequence CTCAACAGTGAGCCGAAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012318623_1012318629 15 Left 1012318623 6:97814061-97814083 CCTGGGGGATGGTTCACTTTAAG No data
Right 1012318629 6:97814099-97814121 CTCAACAGTGAGCCGAAATGGGG No data
1012318625_1012318629 -9 Left 1012318625 6:97814085-97814107 CCCTGAGTCAGCTGCTCAACAGT No data
Right 1012318629 6:97814099-97814121 CTCAACAGTGAGCCGAAATGGGG No data
1012318626_1012318629 -10 Left 1012318626 6:97814086-97814108 CCTGAGTCAGCTGCTCAACAGTG No data
Right 1012318629 6:97814099-97814121 CTCAACAGTGAGCCGAAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012318629 Original CRISPR CTCAACAGTGAGCCGAAATG GGG Intergenic
No off target data available for this crispr