ID: 1012324751

View in Genome Browser
Species Human (GRCh38)
Location 6:97903074-97903096
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012324748_1012324751 -9 Left 1012324748 6:97903060-97903082 CCTGCTCTCCAAGGGAATGATGG No data
Right 1012324751 6:97903074-97903096 GAATGATGGCCTTGAGCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012324751 Original CRISPR GAATGATGGCCTTGAGCATA AGG Intergenic
No off target data available for this crispr