ID: 1012325775

View in Genome Browser
Species Human (GRCh38)
Location 6:97915110-97915132
Sequence GAATCATGGTAGGCTACTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012325775_1012325781 22 Left 1012325775 6:97915110-97915132 CCCGGAGTAGCCTACCATGATTC No data
Right 1012325781 6:97915155-97915177 GCAGTTCAATCCTTCATTCTAGG No data
1012325775_1012325782 30 Left 1012325775 6:97915110-97915132 CCCGGAGTAGCCTACCATGATTC No data
Right 1012325782 6:97915163-97915185 ATCCTTCATTCTAGGCATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012325775 Original CRISPR GAATCATGGTAGGCTACTCC GGG (reversed) Intergenic
No off target data available for this crispr