ID: 1012325781

View in Genome Browser
Species Human (GRCh38)
Location 6:97915155-97915177
Sequence GCAGTTCAATCCTTCATTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012325776_1012325781 21 Left 1012325776 6:97915111-97915133 CCGGAGTAGCCTACCATGATTCA No data
Right 1012325781 6:97915155-97915177 GCAGTTCAATCCTTCATTCTAGG No data
1012325774_1012325781 23 Left 1012325774 6:97915109-97915131 CCCCGGAGTAGCCTACCATGATT No data
Right 1012325781 6:97915155-97915177 GCAGTTCAATCCTTCATTCTAGG No data
1012325775_1012325781 22 Left 1012325775 6:97915110-97915132 CCCGGAGTAGCCTACCATGATTC No data
Right 1012325781 6:97915155-97915177 GCAGTTCAATCCTTCATTCTAGG No data
1012325779_1012325781 8 Left 1012325779 6:97915124-97915146 CCATGATTCATGGCTGTCACTGC No data
Right 1012325781 6:97915155-97915177 GCAGTTCAATCCTTCATTCTAGG No data
1012325778_1012325781 12 Left 1012325778 6:97915120-97915142 CCTACCATGATTCATGGCTGTCA No data
Right 1012325781 6:97915155-97915177 GCAGTTCAATCCTTCATTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012325781 Original CRISPR GCAGTTCAATCCTTCATTCT AGG Intergenic
No off target data available for this crispr