ID: 1012326603

View in Genome Browser
Species Human (GRCh38)
Location 6:97927464-97927486
Sequence TGGGGCTTTTGGCGGTAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012326603_1012326615 30 Left 1012326603 6:97927464-97927486 CCTAGTTACCGCCAAAAGCCCCA No data
Right 1012326615 6:97927517-97927539 TTTCATCATATGAATTTTGGGGG No data
1012326603_1012326609 -1 Left 1012326603 6:97927464-97927486 CCTAGTTACCGCCAAAAGCCCCA No data
Right 1012326609 6:97927486-97927508 ACCTCTTAATACTATCATCTTGG No data
1012326603_1012326613 28 Left 1012326603 6:97927464-97927486 CCTAGTTACCGCCAAAAGCCCCA No data
Right 1012326613 6:97927515-97927537 AGTTTCATCATATGAATTTTGGG 0: 2
1: 67
2: 454
3: 1650
4: 3583
1012326603_1012326612 27 Left 1012326603 6:97927464-97927486 CCTAGTTACCGCCAAAAGCCCCA No data
Right 1012326612 6:97927514-97927536 AAGTTTCATCATATGAATTTTGG No data
1012326603_1012326614 29 Left 1012326603 6:97927464-97927486 CCTAGTTACCGCCAAAAGCCCCA No data
Right 1012326614 6:97927516-97927538 GTTTCATCATATGAATTTTGGGG No data
1012326603_1012326611 2 Left 1012326603 6:97927464-97927486 CCTAGTTACCGCCAAAAGCCCCA No data
Right 1012326611 6:97927489-97927511 TCTTAATACTATCATCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012326603 Original CRISPR TGGGGCTTTTGGCGGTAACT AGG (reversed) Intergenic