ID: 1012326611

View in Genome Browser
Species Human (GRCh38)
Location 6:97927489-97927511
Sequence TCTTAATACTATCATCTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012326602_1012326611 10 Left 1012326602 6:97927456-97927478 CCTCATGACCTAGTTACCGCCAA No data
Right 1012326611 6:97927489-97927511 TCTTAATACTATCATCTTGGAGG No data
1012326601_1012326611 11 Left 1012326601 6:97927455-97927477 CCCTCATGACCTAGTTACCGCCA No data
Right 1012326611 6:97927489-97927511 TCTTAATACTATCATCTTGGAGG No data
1012326603_1012326611 2 Left 1012326603 6:97927464-97927486 CCTAGTTACCGCCAAAAGCCCCA No data
Right 1012326611 6:97927489-97927511 TCTTAATACTATCATCTTGGAGG No data
1012326605_1012326611 -9 Left 1012326605 6:97927475-97927497 CCAAAAGCCCCACCTCTTAATAC No data
Right 1012326611 6:97927489-97927511 TCTTAATACTATCATCTTGGAGG No data
1012326604_1012326611 -6 Left 1012326604 6:97927472-97927494 CCGCCAAAAGCCCCACCTCTTAA No data
Right 1012326611 6:97927489-97927511 TCTTAATACTATCATCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012326611 Original CRISPR TCTTAATACTATCATCTTGG AGG Intergenic