ID: 1012326613

View in Genome Browser
Species Human (GRCh38)
Location 6:97927515-97927537
Sequence AGTTTCATCATATGAATTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012326604_1012326613 20 Left 1012326604 6:97927472-97927494 CCGCCAAAAGCCCCACCTCTTAA No data
Right 1012326613 6:97927515-97927537 AGTTTCATCATATGAATTTTGGG No data
1012326608_1012326613 8 Left 1012326608 6:97927484-97927506 CCACCTCTTAATACTATCATCTT No data
Right 1012326613 6:97927515-97927537 AGTTTCATCATATGAATTTTGGG No data
1012326605_1012326613 17 Left 1012326605 6:97927475-97927497 CCAAAAGCCCCACCTCTTAATAC No data
Right 1012326613 6:97927515-97927537 AGTTTCATCATATGAATTTTGGG No data
1012326603_1012326613 28 Left 1012326603 6:97927464-97927486 CCTAGTTACCGCCAAAAGCCCCA No data
Right 1012326613 6:97927515-97927537 AGTTTCATCATATGAATTTTGGG No data
1012326610_1012326613 5 Left 1012326610 6:97927487-97927509 CCTCTTAATACTATCATCTTGGA No data
Right 1012326613 6:97927515-97927537 AGTTTCATCATATGAATTTTGGG No data
1012326606_1012326613 10 Left 1012326606 6:97927482-97927504 CCCCACCTCTTAATACTATCATC No data
Right 1012326613 6:97927515-97927537 AGTTTCATCATATGAATTTTGGG No data
1012326607_1012326613 9 Left 1012326607 6:97927483-97927505 CCCACCTCTTAATACTATCATCT No data
Right 1012326613 6:97927515-97927537 AGTTTCATCATATGAATTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012326613 Original CRISPR AGTTTCATCATATGAATTTT GGG Intergenic