ID: 1012330816

View in Genome Browser
Species Human (GRCh38)
Location 6:97984067-97984089
Sequence CTGTATTTCATGAGGGATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012330816_1012330820 19 Left 1012330816 6:97984067-97984089 CCAACATCCCTCATGAAATACAG No data
Right 1012330820 6:97984109-97984131 AGGATTATCAAATAGAAATCAGG No data
1012330816_1012330819 -1 Left 1012330816 6:97984067-97984089 CCAACATCCCTCATGAAATACAG No data
Right 1012330819 6:97984089-97984111 GATGAAAACATGTTTAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012330816 Original CRISPR CTGTATTTCATGAGGGATGT TGG (reversed) Intergenic
No off target data available for this crispr