ID: 1012344589

View in Genome Browser
Species Human (GRCh38)
Location 6:98170329-98170351
Sequence GATAGCTGTTGGCCTATTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012344585_1012344589 15 Left 1012344585 6:98170291-98170313 CCTGCCATCTTCTGCAGATAACT 0: 185
1: 187
2: 104
3: 111
4: 225
Right 1012344589 6:98170329-98170351 GATAGCTGTTGGCCTATTACTGG No data
1012344584_1012344589 16 Left 1012344584 6:98170290-98170312 CCCTGCCATCTTCTGCAGATAAC 0: 180
1: 172
2: 120
3: 86
4: 284
Right 1012344589 6:98170329-98170351 GATAGCTGTTGGCCTATTACTGG No data
1012344586_1012344589 11 Left 1012344586 6:98170295-98170317 CCATCTTCTGCAGATAACTACTC 0: 178
1: 192
2: 102
3: 110
4: 247
Right 1012344589 6:98170329-98170351 GATAGCTGTTGGCCTATTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012344589 Original CRISPR GATAGCTGTTGGCCTATTAC TGG Intergenic
No off target data available for this crispr