ID: 1012350439

View in Genome Browser
Species Human (GRCh38)
Location 6:98243737-98243759
Sequence CTTTTAAGTGTACCACAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012350436_1012350439 22 Left 1012350436 6:98243692-98243714 CCCAAAATGCCAGAGACTATGCT No data
Right 1012350439 6:98243737-98243759 CTTTTAAGTGTACCACAATCTGG No data
1012350438_1012350439 13 Left 1012350438 6:98243701-98243723 CCAGAGACTATGCTAAATACTGT No data
Right 1012350439 6:98243737-98243759 CTTTTAAGTGTACCACAATCTGG No data
1012350437_1012350439 21 Left 1012350437 6:98243693-98243715 CCAAAATGCCAGAGACTATGCTA No data
Right 1012350439 6:98243737-98243759 CTTTTAAGTGTACCACAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012350439 Original CRISPR CTTTTAAGTGTACCACAATC TGG Intergenic
No off target data available for this crispr