ID: 1012350710 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:98246689-98246711 |
Sequence | CTCTAGATTCAGATGAAACT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1012350707_1012350710 | 9 | Left | 1012350707 | 6:98246657-98246679 | CCTGTGCACATATCCTAGAAGTC | No data | ||
Right | 1012350710 | 6:98246689-98246711 | CTCTAGATTCAGATGAAACTTGG | No data | ||||
1012350708_1012350710 | -4 | Left | 1012350708 | 6:98246670-98246692 | CCTAGAAGTCAACAACCAACTCT | No data | ||
Right | 1012350710 | 6:98246689-98246711 | CTCTAGATTCAGATGAAACTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1012350710 | Original CRISPR | CTCTAGATTCAGATGAAACT TGG | Intergenic | ||
No off target data available for this crispr |