ID: 1012350710

View in Genome Browser
Species Human (GRCh38)
Location 6:98246689-98246711
Sequence CTCTAGATTCAGATGAAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012350707_1012350710 9 Left 1012350707 6:98246657-98246679 CCTGTGCACATATCCTAGAAGTC No data
Right 1012350710 6:98246689-98246711 CTCTAGATTCAGATGAAACTTGG No data
1012350708_1012350710 -4 Left 1012350708 6:98246670-98246692 CCTAGAAGTCAACAACCAACTCT No data
Right 1012350710 6:98246689-98246711 CTCTAGATTCAGATGAAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012350710 Original CRISPR CTCTAGATTCAGATGAAACT TGG Intergenic
No off target data available for this crispr