ID: 1012356504

View in Genome Browser
Species Human (GRCh38)
Location 6:98320961-98320983
Sequence CTGTAGATGCAGTCTGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012356504_1012356512 27 Left 1012356504 6:98320961-98320983 CCCAGCCCAGACTGCATCTACAG No data
Right 1012356512 6:98321011-98321033 AGTTTCAAAGATGTTCCCTGTGG No data
1012356504_1012356508 -10 Left 1012356504 6:98320961-98320983 CCCAGCCCAGACTGCATCTACAG No data
Right 1012356508 6:98320974-98320996 GCATCTACAGACAACCCATCTGG No data
1012356504_1012356509 -9 Left 1012356504 6:98320961-98320983 CCCAGCCCAGACTGCATCTACAG No data
Right 1012356509 6:98320975-98320997 CATCTACAGACAACCCATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012356504 Original CRISPR CTGTAGATGCAGTCTGGGCT GGG (reversed) Intergenic
No off target data available for this crispr