ID: 1012365566

View in Genome Browser
Species Human (GRCh38)
Location 6:98435231-98435253
Sequence TAGTATGACCATAGCGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012365566_1012365571 8 Left 1012365566 6:98435231-98435253 CCCACCACGCTATGGTCATACTA No data
Right 1012365571 6:98435262-98435284 CCAGTTTAATAACACTGGACTGG No data
1012365566_1012365569 3 Left 1012365566 6:98435231-98435253 CCCACCACGCTATGGTCATACTA No data
Right 1012365569 6:98435257-98435279 ATGCTCCAGTTTAATAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012365566 Original CRISPR TAGTATGACCATAGCGTGGT GGG (reversed) Intergenic
No off target data available for this crispr