ID: 1012367082

View in Genome Browser
Species Human (GRCh38)
Location 6:98454722-98454744
Sequence GCTACAAGCATTGTTCCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012367082_1012367083 -8 Left 1012367082 6:98454722-98454744 CCAGGGGGAACAATGCTTGTAGC No data
Right 1012367083 6:98454737-98454759 CTTGTAGCAATGCTAAAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012367082 Original CRISPR GCTACAAGCATTGTTCCCCC TGG (reversed) Intergenic
No off target data available for this crispr