ID: 1012367922

View in Genome Browser
Species Human (GRCh38)
Location 6:98464854-98464876
Sequence TATTCAGGATCACCAGAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012367915_1012367922 5 Left 1012367915 6:98464826-98464848 CCAAAATTTGAATTTAACCCTCC No data
Right 1012367922 6:98464854-98464876 TATTCAGGATCACCAGAAAGGGG No data
1012367914_1012367922 6 Left 1012367914 6:98464825-98464847 CCCAAAATTTGAATTTAACCCTC No data
Right 1012367922 6:98464854-98464876 TATTCAGGATCACCAGAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012367922 Original CRISPR TATTCAGGATCACCAGAAAG GGG Intergenic
No off target data available for this crispr