ID: 1012369323

View in Genome Browser
Species Human (GRCh38)
Location 6:98483563-98483585
Sequence TCATTCCCACACTCATAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012369322_1012369323 14 Left 1012369322 6:98483526-98483548 CCTTCTGCTACAAGAATCAAAAT No data
Right 1012369323 6:98483563-98483585 TCATTCCCACACTCATAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012369323 Original CRISPR TCATTCCCACACTCATAGCC AGG Intergenic
No off target data available for this crispr