ID: 1012373776

View in Genome Browser
Species Human (GRCh38)
Location 6:98537130-98537152
Sequence CCTCAGCCTCCCAAGTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1107888
Summary {0: 92836, 1: 203589, 2: 246027, 3: 262461, 4: 302975}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012373776_1012373783 3 Left 1012373776 6:98537130-98537152 CCCAGCTACTTGGGAGGCTGAGG 0: 92836
1: 203589
2: 246027
3: 262461
4: 302975
Right 1012373783 6:98537156-98537178 GAGAATTGCTTGAACCTGGGAGG 0: 20147
1: 62565
2: 132669
3: 180845
4: 155163
1012373776_1012373782 0 Left 1012373776 6:98537130-98537152 CCCAGCTACTTGGGAGGCTGAGG 0: 92836
1: 203589
2: 246027
3: 262461
4: 302975
Right 1012373782 6:98537153-98537175 GAGGAGAATTGCTTGAACCTGGG 0: 228
1: 20454
2: 83295
3: 164894
4: 224826
1012373776_1012373784 16 Left 1012373776 6:98537130-98537152 CCCAGCTACTTGGGAGGCTGAGG 0: 92836
1: 203589
2: 246027
3: 262461
4: 302975
Right 1012373784 6:98537169-98537191 ACCTGGGAGGCAGAAGTTGCAGG 0: 19
1: 284
2: 892
3: 1798
4: 5190
1012373776_1012373786 17 Left 1012373776 6:98537130-98537152 CCCAGCTACTTGGGAGGCTGAGG 0: 92836
1: 203589
2: 246027
3: 262461
4: 302975
Right 1012373786 6:98537170-98537192 CCTGGGAGGCAGAAGTTGCAGGG 0: 18
1: 262
2: 800
3: 1509
4: 2302
1012373776_1012373781 -1 Left 1012373776 6:98537130-98537152 CCCAGCTACTTGGGAGGCTGAGG 0: 92836
1: 203589
2: 246027
3: 262461
4: 302975
Right 1012373781 6:98537152-98537174 GGAGGAGAATTGCTTGAACCTGG 0: 351
1: 33275
2: 87439
3: 160096
4: 106992

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012373776 Original CRISPR CCTCAGCCTCCCAAGTAGCT GGG (reversed) Intergenic
Too many off-targets to display for this crispr