ID: 1012373786

View in Genome Browser
Species Human (GRCh38)
Location 6:98537170-98537192
Sequence CCTGGGAGGCAGAAGTTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4891
Summary {0: 18, 1: 262, 2: 800, 3: 1509, 4: 2302}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012373778_1012373786 16 Left 1012373778 6:98537131-98537153 CCAGCTACTTGGGAGGCTGAGGG 0: 990
1: 97260
2: 209019
3: 250859
4: 263158
Right 1012373786 6:98537170-98537192 CCTGGGAGGCAGAAGTTGCAGGG 0: 18
1: 262
2: 800
3: 1509
4: 2302
1012373776_1012373786 17 Left 1012373776 6:98537130-98537152 CCCAGCTACTTGGGAGGCTGAGG 0: 92836
1: 203589
2: 246027
3: 262461
4: 302975
Right 1012373786 6:98537170-98537192 CCTGGGAGGCAGAAGTTGCAGGG 0: 18
1: 262
2: 800
3: 1509
4: 2302
1012373774_1012373786 25 Left 1012373774 6:98537122-98537144 CCTGTAATCCCAGCTACTTGGGA 0: 48553
1: 142115
2: 242012
3: 520212
4: 384467
Right 1012373786 6:98537170-98537192 CCTGGGAGGCAGAAGTTGCAGGG 0: 18
1: 262
2: 800
3: 1509
4: 2302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012373786 Original CRISPR CCTGGGAGGCAGAAGTTGCA GGG Intergenic
Too many off-targets to display for this crispr