ID: 1012378489

View in Genome Browser
Species Human (GRCh38)
Location 6:98590886-98590908
Sequence CTGGGTGTGAGGAGGAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012378479_1012378489 21 Left 1012378479 6:98590842-98590864 CCTTATCAATCCATAAAAGTATT No data
Right 1012378489 6:98590886-98590908 CTGGGTGTGAGGAGGAAGAAAGG No data
1012378478_1012378489 28 Left 1012378478 6:98590835-98590857 CCTGCTGCCTTATCAATCCATAA No data
Right 1012378489 6:98590886-98590908 CTGGGTGTGAGGAGGAAGAAAGG No data
1012378480_1012378489 11 Left 1012378480 6:98590852-98590874 CCATAAAAGTATTACAATTGTTT No data
Right 1012378489 6:98590886-98590908 CTGGGTGTGAGGAGGAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012378489 Original CRISPR CTGGGTGTGAGGAGGAAGAA AGG Intergenic
No off target data available for this crispr