ID: 1012379551

View in Genome Browser
Species Human (GRCh38)
Location 6:98603991-98604013
Sequence CATGCCAAAACAGAGAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012379551_1012379560 18 Left 1012379551 6:98603991-98604013 CCACCTCTCTCTGTTTTGGCATG No data
Right 1012379560 6:98604032-98604054 CACCTGGTGTTACACAGGCTGGG No data
1012379551_1012379558 13 Left 1012379551 6:98603991-98604013 CCACCTCTCTCTGTTTTGGCATG No data
Right 1012379558 6:98604027-98604049 CTTGTCACCTGGTGTTACACAGG No data
1012379551_1012379559 17 Left 1012379551 6:98603991-98604013 CCACCTCTCTCTGTTTTGGCATG No data
Right 1012379559 6:98604031-98604053 TCACCTGGTGTTACACAGGCTGG No data
1012379551_1012379554 2 Left 1012379551 6:98603991-98604013 CCACCTCTCTCTGTTTTGGCATG No data
Right 1012379554 6:98604016-98604038 CCCAACCCTGACTTGTCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012379551 Original CRISPR CATGCCAAAACAGAGAGAGG TGG (reversed) Intergenic
No off target data available for this crispr