ID: 1012379553

View in Genome Browser
Species Human (GRCh38)
Location 6:98604016-98604038
Sequence CCAGGTGACAAGTCAGGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012379553_1012379560 -7 Left 1012379553 6:98604016-98604038 CCCAACCCTGACTTGTCACCTGG No data
Right 1012379560 6:98604032-98604054 CACCTGGTGTTACACAGGCTGGG No data
1012379553_1012379565 18 Left 1012379553 6:98604016-98604038 CCCAACCCTGACTTGTCACCTGG No data
Right 1012379565 6:98604057-98604079 CAAAGCACCCAGGAGTCAGGAGG No data
1012379553_1012379559 -8 Left 1012379553 6:98604016-98604038 CCCAACCCTGACTTGTCACCTGG No data
Right 1012379559 6:98604031-98604053 TCACCTGGTGTTACACAGGCTGG No data
1012379553_1012379566 23 Left 1012379553 6:98604016-98604038 CCCAACCCTGACTTGTCACCTGG No data
Right 1012379566 6:98604062-98604084 CACCCAGGAGTCAGGAGGAAAGG No data
1012379553_1012379563 15 Left 1012379553 6:98604016-98604038 CCCAACCCTGACTTGTCACCTGG No data
Right 1012379563 6:98604054-98604076 GTCCAAAGCACCCAGGAGTCAGG No data
1012379553_1012379562 8 Left 1012379553 6:98604016-98604038 CCCAACCCTGACTTGTCACCTGG No data
Right 1012379562 6:98604047-98604069 AGGCTGGGTCCAAAGCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012379553 Original CRISPR CCAGGTGACAAGTCAGGGTT GGG (reversed) Intergenic
No off target data available for this crispr