ID: 1012379555

View in Genome Browser
Species Human (GRCh38)
Location 6:98604017-98604039
Sequence ACCAGGTGACAAGTCAGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012379555_1012379565 17 Left 1012379555 6:98604017-98604039 CCAACCCTGACTTGTCACCTGGT No data
Right 1012379565 6:98604057-98604079 CAAAGCACCCAGGAGTCAGGAGG No data
1012379555_1012379562 7 Left 1012379555 6:98604017-98604039 CCAACCCTGACTTGTCACCTGGT No data
Right 1012379562 6:98604047-98604069 AGGCTGGGTCCAAAGCACCCAGG No data
1012379555_1012379566 22 Left 1012379555 6:98604017-98604039 CCAACCCTGACTTGTCACCTGGT No data
Right 1012379566 6:98604062-98604084 CACCCAGGAGTCAGGAGGAAAGG No data
1012379555_1012379560 -8 Left 1012379555 6:98604017-98604039 CCAACCCTGACTTGTCACCTGGT No data
Right 1012379560 6:98604032-98604054 CACCTGGTGTTACACAGGCTGGG No data
1012379555_1012379563 14 Left 1012379555 6:98604017-98604039 CCAACCCTGACTTGTCACCTGGT No data
Right 1012379563 6:98604054-98604076 GTCCAAAGCACCCAGGAGTCAGG No data
1012379555_1012379559 -9 Left 1012379555 6:98604017-98604039 CCAACCCTGACTTGTCACCTGGT No data
Right 1012379559 6:98604031-98604053 TCACCTGGTGTTACACAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012379555 Original CRISPR ACCAGGTGACAAGTCAGGGT TGG (reversed) Intergenic
No off target data available for this crispr