ID: 1012379558

View in Genome Browser
Species Human (GRCh38)
Location 6:98604027-98604049
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012379551_1012379558 13 Left 1012379551 6:98603991-98604013 CCACCTCTCTCTGTTTTGGCATG No data
Right 1012379558 6:98604027-98604049 CTTGTCACCTGGTGTTACACAGG No data
1012379552_1012379558 10 Left 1012379552 6:98603994-98604016 CCTCTCTCTGTTTTGGCATGCAC No data
Right 1012379558 6:98604027-98604049 CTTGTCACCTGGTGTTACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012379558 Original CRISPR CTTGTCACCTGGTGTTACAC AGG Intergenic
No off target data available for this crispr