ID: 1012379559

View in Genome Browser
Species Human (GRCh38)
Location 6:98604031-98604053
Sequence TCACCTGGTGTTACACAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012379555_1012379559 -9 Left 1012379555 6:98604017-98604039 CCAACCCTGACTTGTCACCTGGT No data
Right 1012379559 6:98604031-98604053 TCACCTGGTGTTACACAGGCTGG No data
1012379551_1012379559 17 Left 1012379551 6:98603991-98604013 CCACCTCTCTCTGTTTTGGCATG No data
Right 1012379559 6:98604031-98604053 TCACCTGGTGTTACACAGGCTGG No data
1012379553_1012379559 -8 Left 1012379553 6:98604016-98604038 CCCAACCCTGACTTGTCACCTGG No data
Right 1012379559 6:98604031-98604053 TCACCTGGTGTTACACAGGCTGG No data
1012379552_1012379559 14 Left 1012379552 6:98603994-98604016 CCTCTCTCTGTTTTGGCATGCAC No data
Right 1012379559 6:98604031-98604053 TCACCTGGTGTTACACAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012379559 Original CRISPR TCACCTGGTGTTACACAGGC TGG Intergenic
No off target data available for this crispr