ID: 1012379560

View in Genome Browser
Species Human (GRCh38)
Location 6:98604032-98604054
Sequence CACCTGGTGTTACACAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012379553_1012379560 -7 Left 1012379553 6:98604016-98604038 CCCAACCCTGACTTGTCACCTGG No data
Right 1012379560 6:98604032-98604054 CACCTGGTGTTACACAGGCTGGG No data
1012379551_1012379560 18 Left 1012379551 6:98603991-98604013 CCACCTCTCTCTGTTTTGGCATG No data
Right 1012379560 6:98604032-98604054 CACCTGGTGTTACACAGGCTGGG No data
1012379555_1012379560 -8 Left 1012379555 6:98604017-98604039 CCAACCCTGACTTGTCACCTGGT No data
Right 1012379560 6:98604032-98604054 CACCTGGTGTTACACAGGCTGGG No data
1012379552_1012379560 15 Left 1012379552 6:98603994-98604016 CCTCTCTCTGTTTTGGCATGCAC No data
Right 1012379560 6:98604032-98604054 CACCTGGTGTTACACAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012379560 Original CRISPR CACCTGGTGTTACACAGGCT GGG Intergenic
No off target data available for this crispr