ID: 1012379562

View in Genome Browser
Species Human (GRCh38)
Location 6:98604047-98604069
Sequence AGGCTGGGTCCAAAGCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012379556_1012379562 3 Left 1012379556 6:98604021-98604043 CCCTGACTTGTCACCTGGTGTTA No data
Right 1012379562 6:98604047-98604069 AGGCTGGGTCCAAAGCACCCAGG No data
1012379555_1012379562 7 Left 1012379555 6:98604017-98604039 CCAACCCTGACTTGTCACCTGGT No data
Right 1012379562 6:98604047-98604069 AGGCTGGGTCCAAAGCACCCAGG No data
1012379561_1012379562 -10 Left 1012379561 6:98604034-98604056 CCTGGTGTTACACAGGCTGGGTC No data
Right 1012379562 6:98604047-98604069 AGGCTGGGTCCAAAGCACCCAGG No data
1012379552_1012379562 30 Left 1012379552 6:98603994-98604016 CCTCTCTCTGTTTTGGCATGCAC No data
Right 1012379562 6:98604047-98604069 AGGCTGGGTCCAAAGCACCCAGG No data
1012379553_1012379562 8 Left 1012379553 6:98604016-98604038 CCCAACCCTGACTTGTCACCTGG No data
Right 1012379562 6:98604047-98604069 AGGCTGGGTCCAAAGCACCCAGG No data
1012379557_1012379562 2 Left 1012379557 6:98604022-98604044 CCTGACTTGTCACCTGGTGTTAC No data
Right 1012379562 6:98604047-98604069 AGGCTGGGTCCAAAGCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012379562 Original CRISPR AGGCTGGGTCCAAAGCACCC AGG Intergenic
No off target data available for this crispr