ID: 1012386458

View in Genome Browser
Species Human (GRCh38)
Location 6:98688942-98688964
Sequence GCTGTTCACCACCATCTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012386457_1012386458 2 Left 1012386457 6:98688917-98688939 CCTATTCTTAGTGAACATGAAGA No data
Right 1012386458 6:98688942-98688964 GCTGTTCACCACCATCTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012386458 Original CRISPR GCTGTTCACCACCATCTCAC AGG Intergenic
No off target data available for this crispr