ID: 1012389097

View in Genome Browser
Species Human (GRCh38)
Location 6:98716699-98716721
Sequence GTAGCATGTTTGGCTGCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012389097_1012389102 16 Left 1012389097 6:98716699-98716721 CCTGTGGCAGCCAAACATGCTAC No data
Right 1012389102 6:98716738-98716760 CAGAACACATTTTCCTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012389097 Original CRISPR GTAGCATGTTTGGCTGCCAC AGG (reversed) Intergenic
No off target data available for this crispr