ID: 1012389102

View in Genome Browser
Species Human (GRCh38)
Location 6:98716738-98716760
Sequence CAGAACACATTTTCCTCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012389099_1012389102 6 Left 1012389099 6:98716709-98716731 CCAAACATGCTACCTGCAAGGTT No data
Right 1012389102 6:98716738-98716760 CAGAACACATTTTCCTCCTCTGG No data
1012389097_1012389102 16 Left 1012389097 6:98716699-98716721 CCTGTGGCAGCCAAACATGCTAC No data
Right 1012389102 6:98716738-98716760 CAGAACACATTTTCCTCCTCTGG No data
1012389101_1012389102 -6 Left 1012389101 6:98716721-98716743 CCTGCAAGGTTGGAGAGCAGAAC No data
Right 1012389102 6:98716738-98716760 CAGAACACATTTTCCTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012389102 Original CRISPR CAGAACACATTTTCCTCCTC TGG Intergenic
No off target data available for this crispr