ID: 1012390978

View in Genome Browser
Species Human (GRCh38)
Location 6:98739905-98739927
Sequence GGCATGGTGGAACACACCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012390971_1012390978 16 Left 1012390971 6:98739866-98739888 CCATGTATCTATCCAAAAAAATT No data
Right 1012390978 6:98739905-98739927 GGCATGGTGGAACACACCTATGG No data
1012390972_1012390978 4 Left 1012390972 6:98739878-98739900 CCAAAAAAATTTTTTTTAATTAG 0: 12
1: 33
2: 96
3: 395
4: 2338
Right 1012390978 6:98739905-98739927 GGCATGGTGGAACACACCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012390978 Original CRISPR GGCATGGTGGAACACACCTA TGG Intergenic
No off target data available for this crispr