ID: 1012392475

View in Genome Browser
Species Human (GRCh38)
Location 6:98758065-98758087
Sequence GGGAACTAATCTAGTCTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012392475_1012392480 7 Left 1012392475 6:98758065-98758087 CCAGCAAGACTAGATTAGTTCCC No data
Right 1012392480 6:98758095-98758117 TGGGTTACTTCCCATAATAGTGG No data
1012392475_1012392484 23 Left 1012392475 6:98758065-98758087 CCAGCAAGACTAGATTAGTTCCC No data
Right 1012392484 6:98758111-98758133 ATAGTGGGTTTCCATAAAGTTGG No data
1012392475_1012392481 8 Left 1012392475 6:98758065-98758087 CCAGCAAGACTAGATTAGTTCCC No data
Right 1012392481 6:98758096-98758118 GGGTTACTTCCCATAATAGTGGG No data
1012392475_1012392485 24 Left 1012392475 6:98758065-98758087 CCAGCAAGACTAGATTAGTTCCC No data
Right 1012392485 6:98758112-98758134 TAGTGGGTTTCCATAAAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012392475 Original CRISPR GGGAACTAATCTAGTCTTGC TGG (reversed) Intergenic