ID: 1012392481

View in Genome Browser
Species Human (GRCh38)
Location 6:98758096-98758118
Sequence GGGTTACTTCCCATAATAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012392474_1012392481 14 Left 1012392474 6:98758059-98758081 CCTGCTCCAGCAAGACTAGATTA No data
Right 1012392481 6:98758096-98758118 GGGTTACTTCCCATAATAGTGGG No data
1012392475_1012392481 8 Left 1012392475 6:98758065-98758087 CCAGCAAGACTAGATTAGTTCCC No data
Right 1012392481 6:98758096-98758118 GGGTTACTTCCCATAATAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012392481 Original CRISPR GGGTTACTTCCCATAATAGT GGG Intergenic