ID: 1012392484

View in Genome Browser
Species Human (GRCh38)
Location 6:98758111-98758133
Sequence ATAGTGGGTTTCCATAAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012392479_1012392484 2 Left 1012392479 6:98758086-98758108 CCACGAGAATGGGTTACTTCCCA No data
Right 1012392484 6:98758111-98758133 ATAGTGGGTTTCCATAAAGTTGG No data
1012392474_1012392484 29 Left 1012392474 6:98758059-98758081 CCTGCTCCAGCAAGACTAGATTA No data
Right 1012392484 6:98758111-98758133 ATAGTGGGTTTCCATAAAGTTGG No data
1012392478_1012392484 3 Left 1012392478 6:98758085-98758107 CCCACGAGAATGGGTTACTTCCC No data
Right 1012392484 6:98758111-98758133 ATAGTGGGTTTCCATAAAGTTGG No data
1012392475_1012392484 23 Left 1012392475 6:98758065-98758087 CCAGCAAGACTAGATTAGTTCCC No data
Right 1012392484 6:98758111-98758133 ATAGTGGGTTTCCATAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012392484 Original CRISPR ATAGTGGGTTTCCATAAAGT TGG Intergenic