ID: 1012394319

View in Genome Browser
Species Human (GRCh38)
Location 6:98778366-98778388
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012394312_1012394319 -1 Left 1012394312 6:98778344-98778366 CCATCAAGAATGCAGGGGATCCC No data
Right 1012394319 6:98778366-98778388 CAGAAGAAGCAGAGGTGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012394319 Original CRISPR CAGAAGAAGCAGAGGTGGTG GGG Intergenic
No off target data available for this crispr